ALEXIS Biochemicals: AT-ODN-2 (endotoxin-free) (synthetic)

ALX-746-025

Revised 16-Sep-08

AT-ODN-2 (endotoxin-free) (synthetic)
PRODUCT LINE	Inflammation
PRODUCT CATEGORY	Oligodeoxynucleotides [ODNs]

Ordering Information

Product Numbers:	Format:	Size:	Unit Price:	Quantity:	Add To Cart
ALX-746-025-C100		100 µg	250.00 USD

Product Specification

SEQUENCE:	TATAATTTTTACCAACTAGC Nucleotides depicted in italics show the corresponding AT-ODN sequence.
MW:	6374
SOURCE/HOST:	Synthetic.
QUANTITY:	15.8nmol
FORMULATION:	Lyophilized. Sterile.
ENDOTOXIN CONTENT:	<0.02EU/µg (LAL test; BioWhittaker)
RECONSTITUTION:	For a 100µM stock solution, dissolve the total vial content in 158µl endotoxin-free water (included) or PBS (to order separately). To obtain optimal dissolving we recommend the following procedure: - Add 50% of the solvent and let dissolve for 10 min. - Add remaining 50% of the solvent and mix thoroughly. - Moderate warming may aid dissolving.
SHIPPING:	AMBIENT
LONG TERM STORAGE:	+4°C
USE/STABILITY:	Aqueous stock solution is stable for 1 day when stored at +4°C.
HANDLING:	Protect from light. For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C.

Product Description

Lactobacillus gasseri-derived non-CpG ODN of the AT-type; TLR9 (Toll-like receptor 9)-dependent immune activation.

Product Specific Literature References

AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food Microbiol. 65, 149 (2001) Abstract
Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC 326, 782 (2005) Abstract
Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol. 8, 485 (2006) Abstract

General Information

BACKGROUND/TECHNICAL INFORMATION

Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008).

General Literature References

Cutting edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides: T.L. Roberts, et al.; J. Immunol. 174, 605 (2005) Abstract

ALX-505-007	PBS (endotoxin-free)
ALX-746-026	AT-ODN-3 (endotoxin-free) (synthetic)
ALX-746-024	AT-ODN-1 (endotoxin-free) (synthetic)