ALEXIS Biochemicals: Celastrol

Advanced Search

You are here: Product Lines > Immunology > Immunomodulators

Antibiotics - Immunomodulators

Natural Products - Immunomodulators

TLR Agonists / Related Products

Immunomodulators Other Products

ALX-430-096

Revised 24-Feb-05

A77 1726
SYNONYMS	N-(4-Trifluoromethylphenyl)-2-cyano-3-hydroxycrotonamide 2-Cyano-3-hydroxy-N-[4-(trifluoromethyl)phenyl]-2-butenamide
PRODUCT LINE	Signal Transduction
PRODUCT CATEGORY	Tyrosine Kinase Inhibitors

Ordering Information

Product Numbers:	Format:	Size:	Unit Price:	Quantity:	Add To Cart
ALX-430-096-M005		5 mg	45.00 USD
ALX-430-096-M025		25 mg	180.00 USD

Product Specification

FORMULA:	C₁₂H₉F₃N₂O₂
MW:	270.2
CAS NUMBER:	108605-62-5
PURITY:	≥98%
APPEARANCE:	White solid.
SOLUBILITY:	Soluble in DMSO.
SHIPPING:	AMBIENT
LONG TERM STORAGE:	+4°C
HANDLING:	Protect from light. Keep under inert gas.

Product Description

Physiologically active metabolite of the immunosuppressive drug leflunomide (Prod. No. ALX-430-095). Inhibits the activity of dihydrorotate dehydrogenase and of protein tyrosine kinases. Blocks TNF-mediated NF-κB activation in a dose- and time-dependent manner. Also inhibits the activity of cyclooxygenase-2 (COX-2) in vitro and in vivo.

Product Specific Literature References

Inhibition of the epidermal growth factor receptor tyrosine kinase activity by leflunomide: T. Mattar, et al.; FEBS Lett. 334, 161 (1993) Abstract
Inhibition of protein tyrosine phosphorylation in T cells by a novel immunosuppressive agent, leflunomide: X. Xu, et al.; J. Biol. Chem. 270, 12398 (1995) Abstract; Full Text
The immunosuppressive metabolite of leflunomide is a potent inhibitor of human dihydroorotate dehydrogenase: J.P. Davis, et al.; Biochemistry 35, 1270 (1996) Abstract
Two activities of the immunosuppressive metabolite of leflunomide, A77 1726. Inhibition of pyrimidine nucleotide synthesis and protein tyrosine phosphorylation: X. Xu, et al.; Biochem. Pharmacol. 52, 527 (1996) Abstract
The immunosuppressive metabolite of leflunomide, A77 1726, affects murine T cells through two biochemical mechanisms: R.T. Elder, et al.; J. Immunol. 159, 22 (1997) Abstract
In vivo mechanism by which leflunomide controls lymphoproliferative and autoimmune disease in MRL/MpJ-lpr/lpr mice: X. Xu, et al.; J. Immunol. 159, 167 (1997) Abstract
Immunosuppressive leflunomide metabolite (A77 1726) blocks TNF-dependent nuclear factor-kappa B activation and gene expression: S.K. Manna & B.B. Aggarwal; J. Immunol. 162, 2095 (1999) Abstract
A771726, the active metabolite of leflunomide, directly inhibits the activity of cyclo-oxygenase-2 in vitro and in vivo in a substrate-sensitive manner: L.C. Hamilton, et al.; Br. J. Pharmacol. 127, 1589 (1999) Abstract

Further Categories Containing This Product:

NF-kB Pathway Inhibitors • COX Inhibitors • Immunomodulators Other Products

ALX-440-046

Revised 07-Sep-06

4-Amino-(6R)-5,6,7,8-tetrahydro-L-biopterin . dihydrochloride
SYNONYMS	4-Amino-(6R)-BH₄ . 2HCl
PRODUCT LINE	Nitric Oxide Pathway
PRODUCT CATEGORY	NOS Inhibitors (NOS Induction & Enzyme Activity)

Ordering Information

Product Numbers:	Format:	Size:	Unit Price:	Quantity:	Add To Cart
ALX-440-046-M005		5 mg	370.00 USD

Product Specification

FORMULA:	C₉H₁₆N₆O₂ . 2HCl
MW:	240.3 . 73.0
PURITY:	≥99%
APPEARANCE:	White to off-white powder.
SOLUBILITY:	Soluble in water.
SHIPPING:	AMBIENT
LONG TERM STORAGE:	-20°C
USE/STABILITY:	Stable for several years when stored at -20°C. Sensitive to oxidation, especially in neutral and alkaline solutions. Solutions must be stored at -20°C or colder immediately after preparation. Use oxygen free water with the lowest possible pH. Ascorbic acid, DTT or other antioxidants may be added in order to increase stability.

Product Description

Potent, reversible inhibitor of nitric oxide synthases (NOS) at their pterin-site. Inhibits the formation of nitric oxide (NO) by nNOS (NOS I) with IC₅₀=1.1µM for arginine (Prod. No. ALX-101-004) and IC₅₀=1.3µM for N^G-hydroxy-L-arginine (Prod. No. ALX-106-004). Prolongs allograft survival in vivo and rescues rats from septic shock. Immunosuppressant.

Product Specific Literature References

Tetrahydrobiopterin binding to macrophage inducible nitric oxide synthase: heme spin shift and dimer stabilization by the potent pterin antagonist 4-amino-tetrahydrobiopterin: B. Mayer, et al.; Biochemistry 36, 8422 (1997) Abstract
Allosteric modulation of rat brain nitric oxide synthase by the pterin-site enzyme inhibitor 4-aminotetrahydrobiopterin: S. Pfeiffer, et al.; Biochem. J. 328, 349 (1997) Abstract; Full Text
Preferential inhibition of inducible nitric oxide synthase in intact cells by the 4-amino analogue of tetrahydrobiopterin: K. Schmidt, et al.; Eur. J. Biochem. 259, 25 (1999) Abstract; Full Text
Protection against endotoxemia in rats by a novel tetrahydrobiopterin analogue: S. Bahrami, et al.; Shock 13, 386 (2000) Abstract
Inhibition of endotoxin-induced vascular hyporeactivity by 4-amino-tetrahydrobiopterin: H.D. Gibraeil, et al.; Br. J. Pharmacol. 131, 1757 (2000) Abstract
The 4-amino analogue of tetrahydrobiopterin efficiently prolongs murine cardiac-allograft survival: G. Brandacher, et al.; J. Heart Lung Transplant. 20, 747 (2001) Abstract
A 4-amino analogue of tetrahydrobiopterin attenuates endotoxin-induced hemodynamic alterations and organ injury in rats: F. Fitzal, et al.; Shock 18, 158 (2002) Abstract
Biopterin analogues: novel nitric oxide synthase inhibitors with immunosuppressive action: E.R. Werner and G. Werner-Felmayer; Curr. Drug Metab. 3, 119 (2002), (Review) Abstract
Single-turnover of nitric-oxide synthase in the presence of 4-amino-tetrahydrobiopterin: proposed role for tetrahydrobiopterin as a proton donor: M. Sorlie, et al.; J. Biol. Chem. 278, 48602 (2003) Abstract; Full Text
Ability of tetrahydrobiopterin analogues to support catalysis by inducible nitric oxide synthase: formation of a pterin radical is required for enzyme activity: A.R. Hurshman, et al.; Biochemistry 42, 13287 (2003) Abstract
CO exchange of the oxyferrous complexes of endothelial nitric-oxide synthase oxygenase domain in the presence of 4-amino-tetrahydrobiopterin: S. Marchal, et al.; J. Inorg. Biochem. 98, 1217 (2004) Abstract
Tetrahydropteridines suppress gene expression and induce apoptosis of activated RAW264.7 cells via formation of hydrogen peroxide: G. Thoeni, et al.; Free Radic. Biol. Med. 37, 375 (2004) Abstract
Tetrahydro-4-aminobiopterin attenuates dendritic cell-induced T cell priming independently from inducible nitric oxide synthase: G. Thoeni, et al.; J. Immunol. 174, 7584 (2005) Abstract; Full Text

Further Categories Containing This Product:

Immunomodulators Other Products

ALX-340-049

Revised 03-Dec-07

N-Arachidonoyldopamine
SYNONYMS	N-Arachidonoyl-3-hydroxytyramine NADA AA-DA
PRODUCT LINE	Neurobiology
PRODUCT CATEGORY	Endocannabinoids

Ordering Information

Product Numbers:	Format:	Size:	Unit Price:	Quantity:	Add To Cart
ALX-340-049-M001		1 mg	20.00 USD
ALX-340-049-M005		5 mg	35.00 USD

Product Specification

FORMULA:	C₂₈H₄₁NO₃
MW:	439.6
CAS NUMBER:	199875-69-9
PURITY:	≥99% (HPLC)
APPEARANCE:	Lyophilized.
SOLUBILITY:	Soluble in methanol, 100% ethanol or DMSO.
SHIPPING:	SHIPPED ON DRY ICE
LONG TERM STORAGE:	-20°C
HANDLING:	Packaged under inert gas.

Product Description

Endogenous, specific ligand for the CB₁ receptor (CB₁: K_i=250nM; CB₂: K_i=12µM) [1] and TRPV1 [2] (EC₅₀=50nM) found in nervous tissues [3, 4]. Immunosuppressant inhibiting T cell proliferation and phosphorylation of the NF-κB p65 subunit [5]. Potent vasorelaxant [6] and inhibitor of HIV-1 [7].

Product Specific Literature References

[1] N-acyl-dopamines: novel synthetic CB(1) cannabinoid-receptor ligands and inhibitors of anandamide inactivation with cannabimimetic activity in vitro and in vivo: T. Bisogno, et al.; Biochem. J. 351, 817 (2000) Abstract; Full Text
[2] Actions of two naturally occurring saturated N-acyldopamines on transient receptor potential vanilloid 1 (TRPV1) channels: L. De Petrocellis, et al.; Br. J. Pharmacol. 143, 251 (2004) Abstract; Full Text
[3] An endogenous capsaicin-like substance with high potency at recombinant and native vanilloid VR1 receptors: S.M. Huang, et al.; PNAS 99, 8400 (2002) Abstract
[4] Arachidonyl dopamine as a ligand for the vanilloid receptor VR1 of the rat: A. Toth, et al.; Life Sci. 73, 487 (2003) Abstract
[5] Immunosuppressive activity of endovanilloids: N-arachidonoyl-dopamine inhibits activation of the NF-kappa B, NFAT, and activator protein 1 signaling pathways: R. Sancho, et al.; J. Immunol. 172, 2341 (2004) Abstract
[6] Characterisation of the vasorelaxant properties of the novel endocannabinoid N-arachidonoyl-dopamine (NADA): S.E. O'Sullivan, et al.; Br. J. Pharmacol. 141, 803 (2004) Abstract
[7] Mechanisms of HIV-1 inhibition by the lipid mediator N-arachidonoyldopamine: R. Sancho, et al.; J. Immunol. 175, 3990 (2005) Abstract
Synthesis and biological evaluation of novel amides of polyunsaturated fatty acids with dopamine: V. Bezuglov, et al.; Bioorg. Med. Chem. Lett. 11, 447 (2001) Abstract
Modulation of trigeminal sensory neuron activity by the dual cannabinoid-vanilloid agonists anandamide, N-arachidonoyl-dopamine and arachidonyl-2-chloroethylamide: T.J. Price, et al.; Br. J. Pharmacol. 141, 1118 (2004) Abstract
Mechanisms of HIV-1 Inhibition by the Lipid Mediator N-Arachidonoyldopamine: R. Sancho, et al.; J. Immunol. 175, 3990 (2005) Abstract

Further Categories Containing This Product:

Endovanilloids • Immunomodulators Other Products

ALX-350-312

Revised 28-May-08

(-)-Arctigenin
SYNONYMS	(3R,4R)-4-[(3,4-Dimethoxyphenyl)methyl]dihydro-3-[(4-hydroxy-3-methoxyphenyl)methyl]-2-(3H)-furanone
PRODUCT LINE	Natural Products / Antibiotics
PRODUCT CATEGORY	Natural Products - Antitumor Reagents

Ordering Information

Product Numbers:	Format:	Size:	Unit Price:	Quantity:	Add To Cart
ALX-350-312-M025		25 mg	70.00 USD

Product Specification

FORMULA:	C₂₁H₂₄O₆
MW:	372.4
CAS NUMBER:	7770-78-7
SOURCE/HOST:	Isolated from Arctium lappa.
PURITY:	≥97% (HPLC)
APPEARANCE:	White to off-white solid.
SOLUBILITY:	Soluble in DMSO (34mg/ml, heating, sonication); sparingly soluble in water.
SHIPPING:	AMBIENT
LONG TERM STORAGE:	-20°C

Product Description

Lignan derivative, which shows antitumor, anti-inflammatory, immunomodulatory and neuroprotective activities. Down-regulates anti-apoptotic protein Bcl-X_L. Potent inhibitor of HIV type-I integrase and DNA topoisomerase II. Shows phytoestrogenic and cytotoxic properties against Hep62 cells. Antagonist for platelet activating factor and Ca²⁺. Blocks the activation of Akt (protein kinase B; PKB) induced by glucose starvation.

Product Specific Literature References

Antiproliferative effect of Arctigenin and Arctiin: S.Y. Ryu, et al.; Arch. Pharm. Res. 18, 462 (1995)
(-)-Arctigenin as a lead structure for inhibitors of human immunodeficiency virus type-1 integrase: E. Eich, et al.; J. Med. Chem 39, 86 (1996) Abstract
Immunomodulatory effect of arctigenin, a lignan compound, on tumour necrosis factor-alpha and nitric oxide production, and lymphocyte proliferation: J.Y. Cho, et al.; J. Pharm. Pharmacol. 51, 1267 (1999) Abstract
Arctigenin protects cultured cortical neurons from glutamate-induced neurodegeneration by binding to kainate receptor: Y.P. Jang, et al.; J. Neurosci. Res. 68, 233 (2002) 68, 233 (2002) Abstract
A phytochemical study of lignans in whole plants and cell suspension cultures of Anthriscus sylvestris: A. Koulman, et al.; Planta Med. 69, 733 (2003) Abstract
Naturally occurring lignans efficiently induce apoptosis in colorectal tumor cells: B. Hausott, et al.; J. Cancer Res. Clin. Oncol. 129, 569 (2003) Abstract
Arctigenin, a phenylpropanoid dibenzylbutyrolactone lignan, inhibits MAP kinases and AP-1 activation via potent MKK inhibition: the role in TNF-alpha inhibition: M.K. Cho, et al.; Int. Immunopharmacol. 4, 1419 (2004) Abstract
Arctigenin, a phenylpropanoid dibenzylbutyrolactone lignan, inhibits MAP kinases and AP-1 activation via potent MKK inhibition: the role in TNF-alpha inhibition: M.K. Cho, et al.; Int. Immunopharmacol. 4, 1419 (2004) Abstract
Identification of arctigenin as an antitumor agent having the ability to eliminate the tolerance of cancer cells to nutrient starvation: S. Awale, et al.; Cancer Res. 66, 1751 (2006) Abstract
The chemopreventive effects of Saussurea salicifolia through induction of apoptosis and phase II detoxification enzyme: K. Kang, et al.; Biol. Pharm. Bull. 30, 2352 (2007) Abstract

Further Categories Containing This Product:

Bcl-2 Family Modulators • Platelet Activating Factors [PAF] & Receptors / Related Products • Natural Products - Anti-inflammatory Agents • Natural Products - Antiviral / anti-HIV Agents • Natural Products - Topoisomerase Inhibitors • Natural Products - Immunomodulators • Natural Products - Nitric Oxide Pathway Modulators • HIV / AIDS / Related Products

ALX-350-318

Revised 17-Jun-08

(-)-Arctiin
SYNONYMS	(3R,4R)-4-[(3,4-Dimethoxyphenyl)methyl]-3-[[4-(β-D-glucopyranosyloxy)-3-methoxyphenyl]methyl]dihydro-2(3H)-furanone
PRODUCT LINE	Natural Products / Antibiotics
PRODUCT CATEGORY	Natural Products - Antitumor Reagents

Ordering Information

Product Numbers:	Format:	Size:	Unit Price:	Quantity:	Add To Cart
ALX-350-318-M025		25 mg	60.00 USD

Product Specification

FORMULA:	C₂₇H₃₄O₁₁
MW:	534.6
CAS NUMBER:	20362-31-6
SOURCE/HOST:	Isolated from Arctium lappa.
PURITY:	≥95% (HPLC)
APPEARANCE:	White to off-white solid.
SOLUBILITY:	Soluble in DMSO (5mg/ml); sparingly soluble in water.
SHIPPING:	AMBIENT
LONG TERM STORAGE:	-20°C
HANDLING:	Protect from light.

Product Description

Lignan derivative with antitumor activities. Down-regulates anti-apoptotic protein Bcl-X_L. Potent inhibitor of HIV type-I integrase and DNA topoisomerase II. Shows phytoestrogenic activity and is an antagonist for platelet activating factor and Ca²⁺.

Product Specific Literature References

Platelet activating factor (PAF) antagonists contained in medicinal plants: lignans and sesquiterpenes: S. Iwakami, et al.; Chem. Pharm. Bull. (Tokyo) 40, 1196 (1992) Abstract
Antiproliferative effect of Arctigenin and Arctiin: S.Y. Ryu, et al.; Arch. Pharm. Res. 18, 462 (1995)
Cytotoxic components of bardanae fructus (goboshi): S. Moritani, et al.; Biol. Pharm. Bull. 19, 1515 (1996) Abstract
Plant-derived leading compounds for chemotherapy of human immunodeficiency virus (HIV) infection: A.J. Vlietinck, et al.; Planta Med. 64, 97 (1998) Abstract
Anti-tumor-promoting activity of lignans from the aerial part of Saussurea medusa: M. Takasaki, et al.; Cancer Lett. 158, 53 (2000) Abstract
Isolation and identification of arctiin and arctigenin in leaves of burdock (Arctium lappa L.) by polyamide column chromatography in combination with HPLC-ESI/MS: S. Liu, et al.; Phytochem. Anal. 16, 86 (2005) Abstract
Application of preparative high-speed counter-current chromatography for separation and purification of arctiin from Fructus Arctii: X. Wang, et al.; J. Chromatogr. A. 1063, 247 (2005) Abstract
The chemopreventive effects of Saussurea salicifolia through induction of apoptosis and phase II detoxification enzyme: K. Kang, et al.; Biol. Pharm. Bull. 30, 2352 (2007) Abstract

Further Categories Containing This Product:

Natural Products - Immunomodulators • Bcl-2 Family Modulators • Antitumor Agents (Anti-proliferative) • Platelet Activating Factors [PAF] & Receptors / Related Products • Natural Products - Antiviral / anti-HIV Agents • Natural Products - Topoisomerase Inhibitors • HIV / AIDS / Related Products

ALX-380-005

Revised 03-Apr-08

Ascomycin
SYNONYMS	Immunomycin
PRODUCT LINE	Natural Products / Antibiotics
PRODUCT CATEGORY	Antibiotics - Immunomodulators

Ordering Information

Product Numbers:	Format:	Size:	Unit Price:	Quantity:	Add To Cart
ALX-380-005-M001		1 mg	125.00 USD
ALX-380-005-M005		5 mg	540.00 USD

Product Specification

FORMULA:	C₄₃H₆₉NO₁₂
MW:	792.0
CAS NUMBER:	11011-38-4
RTECS:	CI75700000
SOURCE/HOST:	Isolated from Streptomyces sp.
PURITY:	≥95%
APPEARANCE:	White to off-white solid.
SOLUBILITY:	Soluble in DMSO.
SHIPPING:	AMBIENT
LONG TERM STORAGE:	-20°C
HAZARD:	HARMFUL.

Product Description

Antibiotic. Ethyl analog of FK506 (Prod. No. ALX-380-008) with similar immunosuppressant properties. Inhibits calcineurin phosphatase.

Product Specific Literature References

Ascomycin, an antifungal antibiotic: T. Arai, et al.; J. Antibiot. (Tokyo) 15, 23 (1962) Abstract
NMR studies of an FK-506 analog, [U-13C]ascomycin, bound to FK-506-binding protein: A.M. Petros, et al.; J. Med. Chem. 35, 2467 (1992) Abstract
Structure-activity profiles of macrolactam immunosuppressant FK-506 analogues: M. Kawai, et al.; FEBS Lett. 316, 107 (1993) Abstract
Enzymatic synthesis and immunosuppressive activity of novel desmethylated immunomycins (ascomycins): A. Shafiee, et al.; J. Antibiot. (Tokyo) 46, 1397 (1993) Abstract

Further Categories Containing This Product:

PP2B [Calcineurin] / Related Products • Antibiotics - Other Signal Transduction Pathway Modulators

ALX-746-024

Revised 16-Sep-08

AT-ODN-1 (endotoxin-free) (synthetic)
PRODUCT LINE	Inflammation
PRODUCT CATEGORY	Oligodeoxynucleotides [ODNs]

Ordering Information

Product Numbers:	Format:	Size:	Unit Price:	Quantity:	Add To Cart
ALX-746-024-C100		100 µg	250.00 USD

Product Specification

SEQUENCE:	TATAATTTTAATTTCCAAGA Nucleotides depicted in italics show the corresponding AT-ODN sequence.
MW:	6413
SOURCE/HOST:	Synthetic.
QUANTITY:	15.7nmol
FORMULATION:	Lyophilized. Sterile.
ENDOTOXIN CONTENT:	<0.02EU/µg (LAL test; BioWhittaker)
RECONSTITUTION:	For a 100µM stock solution, dissolve the total vial content in 157µl endotoxin-free water (included) or PBS (to order separately). To obtain optimal dissolving we recommend the following procedure: - Add 50% of the solvent and let dissolve for 10 min. - Add remaining 50% of the solvent and mix thoroughly. - Moderate warming may aid dissolving.
SHIPPING:	AMBIENT
LONG TERM STORAGE:	+4°C
USE/STABILITY:	Aqueous stock solution is stable for 1 day when stored at +4°C.
HANDLING:	For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C. Protect from light.

Product Description

IFN-γ inducing non-CpG ODN of the AT-type, found in the Malaria genome; TLR9 (Toll-like receptor 9)-dependent immune activation.

General Information

BACKGROUND/TECHNICAL INFORMATION

Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008).

General Literature References

AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food. Microbiol. 65, 149 (2001) Abstract
Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC 326, 782 (2005) Abstract
Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol. 8, 485 (2006) Abstract
Malaria hemozoin is immunologically inert but radically enhances innate responses by presenting malaria DNA to Toll-like receptor 9: P. Parroche, et al.; PNAS 104, 1919 (2007) Abstract
Malarial fever: hemozoin is involved but Toll-free: R.R. Schumann; PNAS 104, 1743 (2007) Abstract

ALX-505-007	PBS (endotoxin-free)
ALX-746-025	AT-ODN-2 (endotoxin-free) (synthetic)
ALX-746-026	AT-ODN-3 (endotoxin-free) (synthetic)

ALX-505-007	PBS (endotoxin-free)
ALX-746-026	AT-ODN-3 (endotoxin-free) (synthetic)
ALX-746-024	AT-ODN-1 (endotoxin-free) (synthetic)

SEQUENCE:	TATAATTTTTACCAACTAGC Nucleotides depicted in italics show the corresponding AT-ODN sequence.
MW:	6374
SOURCE/HOST:	Synthetic.
QUANTITY:	15.8nmol
FORMULATION:	Lyophilized. Sterile.
ENDOTOXIN CONTENT:	<0.02EU/µg (LAL test; BioWhittaker)
RECONSTITUTION:	For a 100µM stock solution, dissolve the total vial content in 158µl endotoxin-free water (included) or PBS (to order separately). To obtain optimal dissolving we recommend the following procedure: - Add 50% of the solvent and let dissolve for 10 min. - Add remaining 50% of the solvent and mix thoroughly. - Moderate warming may aid dissolving.
SHIPPING:	AMBIENT
LONG TERM STORAGE:	+4°C
USE/STABILITY:	Aqueous stock solution is stable for 1 day when stored at +4°C.
HANDLING:	Protect from light. For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C.