• Home
  • Sitemap
  • Help
  • Technical Support
  • Contact
Toll-like Receptors [TLRs] / Related Products
You are here: Product Lines > Signal Transduction > Inflammation > Toll-like Receptors [TLRs] / Related Products
Toolbar - View Selection
 
 Items 1-20 of 119 Page 1 of 6 Select Page: 1 2 3 4 5 6  >>  
ALX-746-024 Revised 16-Sep-08 New product
AT-ODN-1 (endotoxin-free) (synthetic)
Add to Clipboard
PRODUCT LINE Inflammation
PRODUCT CATEGORY Oligodeoxynucleotides [ODNs]
Ordering Information
Product Numbers: Format: Size: Unit Price: Quantity: Add To Cart
ALX-746-024-C100   100 µg 250.00 USD Add To Cart
Product Specification
SEQUENCE: TATAATTTTAATTTCCAAGA
Nucleotides depicted in italics show the corresponding AT-ODN sequence.
MW: 6413
SOURCE/HOST: Synthetic.
QUANTITY: 15.7nmol
FORMULATION: Lyophilized. Sterile.
ENDOTOXIN CONTENT: <0.02EU/µg (LAL test; BioWhittaker)
RECONSTITUTION: For a 100µM stock solution, dissolve the total vial content in 157µl endotoxin-free water (included) or PBS (to order separately).
To obtain optimal dissolving we recommend the following procedure:
- Add 50% of the solvent and let dissolve for 10 min.
- Add remaining 50% of the solvent and mix thoroughly.
- Moderate warming may aid dissolving.
SHIPPING: AMBIENT
LONG TERM STORAGE: +4°C
USE/STABILITY: Aqueous stock solution is stable for 1 day when stored at +4°C.
HANDLING: For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C. Protect from light.
Product Description

IFN-γ inducing non-CpG ODN of the AT-type, found in the Malaria genome; TLR9 (Toll-like receptor 9)-dependent immune activation.

General Information
BACKGROUND/TECHNICAL INFORMATION Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008).
General Literature References
AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food. Microbiol. 65, 149 (2001) Abstract
Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC 326, 782 (2005) Abstract
Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol. 8, 485 (2006) Abstract
Malaria hemozoin is immunologically inert but radically enhances innate responses by presenting malaria DNA to Toll-like receptor 9: P. Parroche, et al.; PNAS 104, 1919 (2007) Abstract
Malarial fever: hemozoin is involved but Toll-free: R.R. Schumann; PNAS 104, 1743 (2007) Abstract
 
 
ALX-746-025 Revised 16-Sep-08 New product
AT-ODN-2 (endotoxin-free) (synthetic)
Add to Clipboard
PRODUCT LINE Inflammation
PRODUCT CATEGORY Oligodeoxynucleotides [ODNs]
Ordering Information
Product Numbers: Format: Size: Unit Price: Quantity: Add To Cart
ALX-746-025-C100   100 µg 250.00 USD Add To Cart
Product Specification
SEQUENCE: TATAATTTTTACCAACTAGC
Nucleotides depicted in italics show the corresponding AT-ODN sequence.
MW: 6374
SOURCE/HOST: Synthetic.
QUANTITY: 15.8nmol
FORMULATION: Lyophilized. Sterile.
ENDOTOXIN CONTENT: <0.02EU/µg (LAL test; BioWhittaker)
RECONSTITUTION: For a 100µM stock solution, dissolve the total vial content in 158µl endotoxin-free water (included) or PBS (to order separately).
To obtain optimal dissolving we recommend the following procedure:
- Add 50% of the solvent and let dissolve for 10 min.
- Add remaining 50% of the solvent and mix thoroughly.
- Moderate warming may aid dissolving.
SHIPPING: AMBIENT
LONG TERM STORAGE: +4°C
USE/STABILITY: Aqueous stock solution is stable for 1 day when stored at +4°C.
HANDLING: Protect from light. For maximum product recovery after thawing, centrifuge the vial before opening the cap. After reconstitution, prepare aliquots and store at -20°C.
Product Description

Lactobacillus gasseri-derived non-CpG ODN of the AT-type; TLR9 (Toll-like receptor 9)-dependent immune activation.

Product Specific Literature References
AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food Microbiol. 65, 149 (2001) Abstract
Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC 326, 782 (2005) Abstract
Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol. 8, 485 (2006) Abstract
General Information
BACKGROUND/TECHNICAL INFORMATION Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008).
General Literature References
Cutting edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides: T.L. Roberts, et al.; J. Immunol. 174, 605 (2005) Abstract
 
 
ALX-746-026 Revised 16-Sep-08 New product
AT-ODN-3 (endotoxin-free) (synthetic)
Add to Clipboard
PRODUCT LINE Inflammation
PRODUCT CATEGORY Oligodeoxynucleotides [ODNs]
Ordering Information
Product Numbers: Format: Size: Unit Price: Quantity: Add To Cart
ALX-746-026-C100   100 µg 250.00 USD Add To Cart
Product Specification
SEQUENCE: TTAACAATTTTTACCCAAGA
Nucleotides depicted in italics show the corresponding AT-ODN sequence.
MW: 6382
SOURCE/HOST: Synthetic.
QUANTITY: 15.7nmol
FORMULATION: Lyophilized. Sterile.
ENDOTOXIN CONTENT: <0.02EU/µg (LAL test; BioWhittaker)
RECONSTITUTION: For a 100µM stock solution, dissolve the total vial content in 157µl endotoxin-free water (included) or PBS (to order separately).
To obtain optimal dissolving we recommend the following procedure:
- Add 50% of the solvent and let dissolve for 10 min.
- Add remaining 50% of the solvent and mix thoroughly.
- Moderate warming may aid dissolving.
SHIPPING: AMBIENT
LONG TERM STORAGE: +4°C
USE/STABILITY: Aqueous stock solution is stable for 1 day when stored at +4°C.
HANDLING: Protect from light. After reconstitution, prepare aliquots and store at -20°C. For maximum product recovery after thawing, centrifuge the vial before opening the cap.
Product Description

Lactobacillus gasseri-derived non-CpG ODN of the AT-type; TLR9 (Toll-like receptor 9)-dependent immune activation.

Product Specific Literature References
AT oligonucleotides inducing B lymphocyte activation exist in probiotic Lactobacillus gasseri: H. Kitazawa, et al.; Int. J. Food Microbiol. 65, 149 (2001) Abstract
Augmentation of T(H)-1 type response by immunoactive AT oligonucleotide from lactic acid bacteria via Toll-like receptor 9 signaling: T. Shimosato, et al.; BBRC 326, 782 (2005) Abstract
Strong immunostimulatory activity of AT-oligodeoxynucleotide requires a six-base loop with a self-stabilized 5’-C...G-3’ stem structure: T. Shimosato, et al.; Cell. Microbiol. 8, 485 (2006) Abstract
General Information
BACKGROUND/TECHNICAL INFORMATION Includes 1 vial of ddWater (endotoxin-free) (Prod. No. ALX-505-008).
General Literature References
Cutting edge: species-specific TLR9-mediated recognition of CpG and non-CpG phosphorothioate-modified oligonucleotides: T.L. Roberts, et al.; J. Immunol. 174, 605 (2005) Abstract
 
 
ALX-430-064 Revised 15-Sep-08
Auranofin
Add to Clipboard
PRODUCT LINE Inflammation
PRODUCT CATEGORY Lipoxygenases / Related Products
Ordering Information
Product Numbers: Format: Size: Unit Price: Quantity: Add To Cart
ALX-430-064-M025   25 mg 35.00 USD Add To Cart
ALX-430-064-M100   100 mg 68.00 USD Add To Cart
Product Specification
FORMULA: C20H34AuO9PS
MW: 678.5
CAS NUMBER: 34031-32-8
MERCK INDEX: 14: 878
PURITY: ≥98%
APPEARANCE: White to off-white powder.
SOLUBILITY: Soluble in DMSO (5mg/ml) or 100% ethanol (4mg/ml).
SHIPPING: AMBIENT
LONG TERM STORAGE: +20°C
USE/STABILITY: Solutions are stable for up to 3 months when stored at -20 °C.
HAZARD: TOXIC.

Product Description
Gold derivative in clinical use as an anti-arthritic. Acts as an inhibitor of several leukocyte activation pathways. Inhibits release of inflammatory mediators from human macrophages, pulmonary mast cell and basophils. Also inhibits human neutrophil 5-lipoxygenase. Efficient inducer of mitochondrial membrane permeability transition pore in the presence of calcium ions, potentially referable to its inhibition of mitochondrial thioredoxin reductase.
Product Specific Literature References
Antiarthritic gold compounds effectively quench electronically excited singlet oxygen: E.J. Corey, et al.; Science 236, 68 (1987) Abstract
Modulation of mediator release from human basophils and pulmonary mast cells and macrophages by auranofin: M. Columbo, et al.; Biochem. Pharmacol. 39, 285 (1990) Abstract
Auranofin stimulates LTA hydrolase and inhibits 5-lipoxygenase/LTA synthase activity of isolated human neutrophils: W.H. Betts, et al.; Biochem. Pharmacol. 39, 1233 (1990) Abstract
Auranofin inhibits the activation pathways of polymorphonuclear leukocytes at multiple sites: R. Rudkowski, et al.; Biochem. Pharmacol. 41, 1921 (1991) Abstract
Induction of mitochondrial permeability transition by auranofin, a Gold(I)-phosphine derivative: M.P. Rigobello, et al.; Br. J. Pharmacol. 136, 1162 (2002) Abstract
General Literature References
Auranofin: W.F. Kean, et al.; Br. J. Theumatol. 36, 560 (1997), (Review) Abstract; Full Text
 
 
ALX-201-133 Revised 19-Feb-08
CD14 (human) (recombinant)
Add to Clipboard
PRODUCT LINE Inflammation
PRODUCT CATEGORY CD14 / Related Products
Ordering Information
Product Numbers: Format: Size: Unit Price: Quantity: Add To Cart
ALX-201-133-C010   10 µg 270.00 USD Add To Cart
Product Specification
MW: ~50kDa.
SOURCE/HOST: Produced in CHO cells.
CONCENTRATION: 1mg/ml after reconstitution.
PURITY: ~90-95% (SDS-PAGE)
PURITY DETAIL: Affinity purified using MAb to CD14 (human) (biG 2/RoMo-1) (Prod. No. ALX-804-498).
FORMULATION: Lyophilized from PBS, pH 7.2.
ENDOTOXIN CONTENT: <0.00015EU/µg protein (LAL test; Chromogenix).
RECONSTITUTION: Reconstitute with 10µl distilled water. Further dilutions should be made with PBS
BIOLOGICAL ACTIVITY: Inhibits binding of LPS to CD14. Up to 20µg/ml CD14 inhibit binding of FITC-LPS (0.5µg/ml) to 6x105 CD14+ CHO transfectants (FACS).
SHIPPING: SHIPPED ON DRY ICE
LONG TERM STORAGE: -80°C
HANDLING: Avoid freeze/thaw cycles.
Product Images
Please click on thumbnails to enlarge.
Product Specific Literature References
Both membrane-bound and soluble forms of CD14 bind to gram-negative bacteria: R.S. Jack, et al.; Eur. J. Immunol. 25, 1436 (1995) Abstract
The myeloid differentiation antigen CD14 is N- and O-glycosylated. Contribution of N-linked glycosylation to different soluble CD14 isoforms: F. Stelter, et al.; Eur. J. Biochem. 236, 457 (1996) Abstract
Proteolysis of monocyte CD14 by human leukocyte elastase inhibits lipopolysaccharide-mediated cell activation: K. Le-Barillec, et al.; J. Clin. Invest. 103, 1039 (1999) Abstract; Full Text
General Information
The myeloid differentiation antigen CD14 acts as the major receptor for bacterial LPS. The dominant form of the recombinant wildtype CD14 ist the 50kDa protein.
The CD14 glycoprotein, gp 55, is present on most monocytic and macrophage like cell types: monocytes, macrophages, Kupffer cells, pleural phagocytic cells and dendritic reticular cells. CD14 is also observed on granulocytes and activated or transformed B-cells. Furthermore it is present in a soluble form in mouse serum, urine and other body fluids.
MANUFACTURER Manufactured by Biometec.
Further Categories Containing This Product:
CD ProteinsRecombinant Proteins / Fusion Proteins
 
 
ALX-201-134 Revised 25-Sep-08
CD14 (mouse) (recombinant) (His)
Add to Clipboard
PRODUCT LINE Inflammation
PRODUCT CATEGORY CD14 / Related Products
Ordering Information
Product Numbers: Format: Size: Unit Price: Quantity: Add To Cart
ALX-201-134-C010   10 µg 370.00 USD Add To Cart
Product Specification
MW: ~45kDa
SOURCE/HOST: Produced in CHO cells.
CONCENTRATION: 1mg/ml after reconstitution.
PURITY DETAIL: His-tag-affinity purified.
FORMULATION: Lyophilized from PBS, pH 7.2.
ENDOTOXIN CONTENT: <0.00015EU/µg protein (LAL test; Chromogenix).
RECONSTITUTION: Reconstitute with 10µl distilled water.
BIOLOGICAL ACTIVITY: Inhibits binding of LPS to CD14. Up to 5µg/ml mouse CD14 inhibit binding of FITC-LPS (0.5µg/ml) to mouse CD14+ CHO transfectants (FACS).
SHIPPING: SHIPPED ON DRY ICE
LONG TERM STORAGE: -80°C
HANDLING: Avoid freeze/thaw cycles.
Product Specific Literature References
Monocytes can phagocytose Gram-negative bacteria by a CD14-dependent mechanism: U. Grunwald, et al.; J. Immunol. 157, 4119 (1996) Abstract
General Information
The myeloid differentiation antigen CD14 acts as the major receptor for bacterial LPS. The dominant form of the recombinant wildtype CD14 ist the 50kDa protein.
MANUFACTURER Manufactured by Biometec.
Further Categories Containing This Product:
CD ProteinsRecombinant Proteins / Fusion Proteins
 
 
ALX-850-302 Revised 16-Nov-05
CD14, Soluble (human) Detection Set [For ELISA Application]
Add to Clipboard
PRODUCT LINE Inflammation
PRODUCT CATEGORY CD14 / Related Products
Ordering Information
Product Numbers: Format: Size: Unit Price: Quantity: Add To Cart
ALX-850-302-KI01   1 Set 690.00 USD Add To Cart
Product Specification
QUANTITY: 96 wells (~80 tests).
FORMULATION: All reagents are stabilized with 0.01% thimerosal.
APPLICATION: For the quantitative detection of soluble human CD14 levels.
SHIPPING: SHIPPED ON BLUE ICE
SHORT TERM STORAGE: +4°C
LONG TERM STORAGE: -20°C
General Information
MANUFACTURER Manufactured by Biometec.
Further Categories Containing This Product:
ELISA Sets
 
 
ALX-850-303 Revised 16-Nov-05
CD14, Soluble (mouse) Detection Set [For ELISA Application]
Add to Clipboard
PRODUCT LINE Inflammation
PRODUCT CATEGORY CD14 / Related Products
Ordering Information
Product Numbers: Format: Size: Unit Price: Quantity: Add To Cart
ALX-850-303-KI01   1 Set 990.00 USD Add To Cart
Product Specification
QUANTITY: 96 wells (~80 tests).
FORMULATION: All reagents are stabilized with 0.01% thimerosal.
APPLICATION: For the quantitative detection of soluble mouse CD14 levels.
SHIPPING: SHIPPED ON BLUE ICE
SHORT TERM STORAGE: +4°C
LONG TERM STORAGE: -20°C
General Information
MANUFACTURER Manufactured by Biometec.
Further Categories Containing This Product:
ELISA Sets
 
 
ALX-505-008 Revised 09-Sep-08
ddWater (endotoxin-free)
Add to Clipboard
PRODUCT LINE Molecular Biology
PRODUCT CATEGORY Buffers / Detergents / Solutions
Ordering Information
Product Numbers: Format: Size: Unit Price: Quantity: Add To Cart
ALX-505-008-LD15   1.5 ml 45.00 USD Add To Cart
Product Specification
SHIPPING: AMBIENT
LONG TERM STORAGE: +4°C
Product Description
Sterile, double distilled endotoxin-free water for use with TLRgrade™ or endotoxin-free grade reagents. Product has been subjected to multiple rounds of LPS removal by adsorption with activated charcoal [1].

Related Products:

ODN 1668 (TLRgrade™) (synthetic) (Prod. No. ALX-746-001)    
ODN 1826 (TLRgrade™) (synthetic) (Prod. No. ALX-746-002)      
ODN 1585 (TLRgrade™) (synthetic) (Prod. No. ALX-746-003)     
ODN M362 (TLRgrade™) (synthetic) (Prod. No. ALX-746-004)    
ODN 2216 (TLRgrade™) (synthetic) (Prod. No. ALX-746-005)      
ODN 2006 (TLRgrade™) (synthetic) (Prod. No. ALX-746-006)    
ODN 2395 (TLRgrade™) (synthetic) (Prod. No. ALX-746-020)     
Poly(I:C) . potassium salt (TLRgrade™) (synthetic) (Prod. No. ALX-746-021)
Poly(dA:dT) (endotoxin-free) (synthetic) (Prod. No. ALX-746-022)
Oligo(dA:dT) (endotoxin-free) (synthetic) (Prod. No. ALX-746-023)
AT-ODN-1 (endotoxin-free) (synthetic) (Prod. No. ALX-746-024)
AT-ODN-2 (endotoxin-free) (synthetic) (Prod. No. ALX-746-025)
AT-ODN-3 (endotoxin-free) (synthetic) (Prod. No. ALX-746-026)
ODN 1668 (TLRgrade™) (synthetic) (BULK) (Prod. No. ALX-746-051)
ODN 1826 (TLRgrade™) (synthetic) (BULK) (Prod. No. ALX-746-052)      
ODN 2216 (TLRgrade™) (synthetic) (BULK) (Prod. No. ALX-746-055)      
ODN 2006 (TLRgrade™) (synthetic) (BULK) (Prod. No. ALX-746-056)
ODN 1720 (TLRgrade™) (synthetic) (Control) (Prod. No. ALX-746-200)    
ODN 1982 (TLRgrade™) (synthetic) (Control) (Prod. No. ALX-746-201)     
ODN 2118 (TLRgrade™) (synthetic) (Control) (Prod. No. ALX-746-203)     
ODN M383 (TLRgrade™) (synthetic) (Control) (Prod. No. ALX-746-204)     
ODN 2243 (TLRgrade™) (synthetic) (Control) (Prod. No. ALX-746-205)   
ODN 2137 (TLRgrade™) (synthetic) (Control) (Prod. No. ALX-746-206)
iODN 2088 (TLRgrade™) (synthetic) (Inhibitory for mouse) (Prod. No. ALX-746-250)
iODN (ttaggg)4 (TLRgrade™) (synthetic) (Inhibitory for human) (Prod. No. ALX-746-251)

Product Specific Literature References
The removal of 14C labeled endotoxin by activated charcoal: A.S. Pegues, et al.; Int. J. Artif. Organs 2, 153 (1979) Abstract